GO935217

EST Overview
NameGO935217
Unique NameGO935217
TypeEST
OrganismCicer arietinum (chickpea)
Sequence length118
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
Cicer arietinum unigene v12010-12-27
Relationships

This EST is a part of the following contig feature(s):

Feature NameUnique NameSpeciesType
Cicer_arietinum_v1_Contig1729Cicer_arietinum_v1_Contig1729Cicer arietinumcontig


Unigenes
This EST is part of the following unigenes:
Unigene NameAnalysis NameSequence type in Unigene
Cicer arietinum unigene v1Cicer arietinum unigene v1EST
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Cicer_arietinum_v1_Contig1729contigCicer_arietinum_v1_Contig1729:503..620 +
Sequences
The following sequences are available for this feature:

EST sequence

>GO935217 ID=GO935217|Name=GO935217|organism=Cicer arietinum|type=EST|length=118bp
AAGGAGATCAGCGACGCGTTCGCCGTGGTAAGGATCAATGTGAAATCCAG
ATTTTCCATGAACAATAATCTCAGCAGGACCACCAGTTACTCAGGACTCA
TCAATCACTAGTGAATTC
back to top