DR749504

EST Overview
NameDR749504
Unique NameDR749504
TypeEST
OrganismCicer arietinum (chickpea)
Sequence length517
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
Cicer arietinum unigene v12010-12-27
Relationships

This EST is a part of the following contig feature(s):

Feature NameUnique NameSpeciesType
Cicer_arietinum_v1_Contig1110Cicer_arietinum_v1_Contig1110Cicer arietinumcontig


Unigenes
This EST is part of the following unigenes:
Unigene NameAnalysis NameSequence type in Unigene
Cicer arietinum unigene v1Cicer arietinum unigene v1EST
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Cicer_arietinum_v1_Contig1110contigCicer_arietinum_v1_Contig1110:131..648 -
Sequences
The following sequences are available for this feature:

EST sequence

>DR749504 ID=DR749504|Name=DR749504|organism=Cicer arietinum|type=EST|length=517bp
ATTACGCCAGCAGTACTAGAGTTACTTAGTTCAGACTCGAGCTCTCTCAG
TGAGCTCATCAAACCATTGCATGTCTCTAGAAATCCATCTGATGCACCTT
GGATTCCACCTATTTCCGCCTGCATAACATCAATAGTGCTGTGGATTTTC
TCCAATGCCGCTCAATGGAAGAAATCTCTTGTGGGGGATAGAGGCAAGCT
CCAATCTCATCAATCTGTTGGCCAAGTTCTTGACAAAGCTGCAACAATTT
TTCAAGTGAATCTACAAAACTGCTGTTGTCATTTGGTTTTTCCATCTTAT
TCAAGCCTGTGGTGGAGCGAATTAGTTCTTTTAGGACTGAAAGTGTGTCA
GACACAACTGCAATGGCTCTTTCAGCCACTTTCATCTCTTCAGGTGATAG
GTCGTTCCCTATATCACCGTCACTTGAATTATTATTGCATGGTTCAGACT
CTGTTTCTGCACAACTATTGTCACAGGATCATCACTAGAATCTGGGTTCA
ATCTTTCATCTCGCGTA
back to top