GR420691

EST Overview
NameGR420691
Unique NameGR420691
TypeEST
OrganismCicer arietinum (chickpea)
Sequence length547
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
Cicer arietinum unigene v12010-12-27
Unigenes
This EST is part of the following unigenes:
Unigene NameAnalysis NameSequence type in Unigene
Cicer arietinum unigene v1Cicer arietinum unigene v1EST
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Cicer_arietinum_v1_Contig1368contigCicer_arietinum_v1_Contig1368:1..547 +
Sequences
The following sequences are available for this feature:

EST sequence

>GR420691 ID=GR420691|Name=GR420691|organism=Cicer arietinum|type=EST|length=547bp
GGATGTCTTTGCATTGGTGCTGGAATCTAGTGGAAGTGATCTCCCAGTTG
TCATATCATGTGCTAGTCTTGCCTTGGCAGATGCTGGAATACTGATGTAT
GACCTTGTTGCCTCAGTTTCTGTGTCATGTCTTGGTAAGAACCTCATCAT
TGATCCTATTTCGGAGGAGGAAAATTGCCAAGATGGAAGCATAATGATTA
CTTGCATGCCTTCTCGCTATGAAATCACCCAACTGACAGTTACCGGAGAA
TGGTCCACTCCAAAGATTAACGAGGGGATGCAGCTGTGTTTGGATGCTTG
TGCGAAGCTTGCTAAGATTATGAGGACATGTTTGAAAGAATCCGCATCTG
ATGCACAGGATGATAGCTCTTAGCAACACAAAGATCGCTTTTAAATTGCT
TCGTTTTTTTATCTCTTCTACCTCAACATTGGAAGAGAATTTTGTGTTAG
GAAGGAGGTAGGGTTAAGATGCCTTTTATGTGATGCAGATTTTGCCTTTA
CGAGCTTCTCAAAAGATAATGTGAAAGTTAATTAGTTAATATTGCAT
back to top
Relationships

This EST is a part of the following contig feature(s):

Feature NameUnique NameSpeciesType
Cicer_arietinum_v1_Contig1368Cicer_arietinum_v1_Contig1368Cicer arietinumcontig