EL585389

EST Overview
NameEL585389
Unique NameEL585389
TypeEST
OrganismCicer arietinum (chickpea)
Sequence length554
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
Cicer arietinum unigene v12010-12-27
Relationships

This EST is a part of the following contig feature(s):

Feature NameUnique NameSpeciesType
Cicer_arietinum_v1_Contig2446Cicer_arietinum_v1_Contig2446Cicer arietinumcontig


Libraries
Library NameType
LIBEST_020862 Chickpea Insect-Induced Librarycdna_library
Unigenes
This EST is part of the following unigenes:
Unigene NameAnalysis NameSequence type in Unigene
Cicer arietinum unigene v1Cicer arietinum unigene v1EST
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Cicer_arietinum_v1_Contig2446contigCicer_arietinum_v1_Contig2446:233..788 +
Sequences
The following sequences are available for this feature:

EST sequence

>EL585389 ID=EL585389|Name=EL585389|organism=Cicer arietinum|type=EST|length=554bp
AGAAGGCCAAAAAAGATCCCAACAAACCGAAAAGACCTCCGAGCGCTTTC
TTTGTCTTCCTTGAGGAGTTCAGAAAGACCTTTAAGGCAGAAAATCCTAC
TGTGAAGGCCGTATCAGCTGTTGGAAAGGCTGGAGGAGAAAAATGGAAAT
CCTTGACTAAGGCCGAAAAAGCTCCATATGAAGCCAAGGCTGCAAAAAGG
AAAGTTGAGTATGAAAAACTTCTGAATGCTTATAACAACAAGGCAAGTTC
AGCGGATGATGAGGAGGAGGAATCTGACAAATCCAAATCCGAAGTTAATA
ATGAAGATGAAGCAAGTGTAGAGGATGACCACCAAGACGAGGATGATGAT
GATGAGGACGACGATGATGATGAGGAAGATGATGATTGAGATTGGTGTGT
ATAAATTAAGATATGATGTTTCATTGGTGGAGGGAGGCTATTNATATAGT
TTGTCTCTGCATATTAGGATACTTTTGGATATTTNGTGTTGGTTGAATAT
CTGTCTTGTCTTGCTGGTATGATATTTTGCCAGCTTCCCTCAGTTGTTAG
TTAT
back to top