CaM0886, CaM0886 (genetic_marker) Cicer arietinum

Marker Overview
NameCaM0886
Genbank IDEI866534
TypeSSR
SpeciesCicer arietinum
GermplasmICC4958
Repeat Motif(AT)17
Primer 1CaM0886.Forward primer: TGAGAATTTTTCTTGAACTTGAACTG
Primer 2CaM0886.Reverse primer: AAGTCTTTTCCAGCACTTTTGC
Product Length256
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankEI866534
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerCaM0886.Forward primerCicer arietinumprimer
Reverse primerCaM0886.Reverse primerCicer arietinumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CaM0886CaM0886Cicer arietinummarker_locus
CaM0886CaM0886-2.71Cicer arietinummarker_locus


Germplasm
Stock NameType
ICC4958cultivar
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-ICC4958xPI489777-RIL-F10LG3N/A45.08CaM0886View
2chickpea-ICCV96029×CDCFrontier-F2-2017CaLG03N/A3.5CaM0886View
3chickpea-ICC5810×CDCFrontier-F2-2017CaLG03N/A1.2CaM0886View
4chickpea-BGD132×CDCFrontier-F2-2017CaLG03N/A4.1CaM0886View
5chickpea-ICC16641×CDCFrontier-F2-2017CaLG03N/A5.5CaM0886View
6chickpea-flowering_time_consensus_map-F2-2017CaLG03N/A13.9CaM0886View
7Chickpea-JG62/ICCV05530-RILLG03N/A2.71CaM0886View