CaM1122, CaM1122 (genetic_marker) Cicer arietinum

Marker Overview
NameCaM1122
Genbank IDEI871582
TypeSSR
SpeciesCicer arietinum
GermplasmICC4958
Repeat Motif(AG)21
Primer 1CaM1122.Forward primer: CCAAAGGGGTGAGTTTTTGA
Primer 2CaM1122.Reverse primer: CCCCCTTAATTTCTTTCTCCA
Product Length249
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankEI871582
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerCaM1122.Forward primerCicer arietinumprimer
Reverse primerCaM1122.Reverse primerCicer arietinumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CaM1122CaM1122Cicer arietinummarker_locus


Germplasm
Stock NameType
ICC4958cultivar
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-C214xILC3279-F2LG3N/A26.1CaM1122View
2chickpea-ICC4958xPI489777-RIL-F10LG3N/A40.58CaM1122View
3chickpea-ICCV96029×CDCFrontier-F2-2017CaLG03N/A0CaM1122View
4chickpea-BGD132×CDCFrontier-F2-2017CaLG03N/A7.5CaM1122View
5chickpea-ICC16641×CDCFrontier-F2-2017CaLG03N/A0CaM1122View
6chickpea-flowering_time_consensus_map-F2-2017CaLG03N/A9.9CaM1122View