CaM1515, CaM1515 (genetic_marker) Cicer arietinum

Marker Overview
NameCaM1515
Genbank IDEI879617
TypeSSR
SpeciesCicer arietinum
GermplasmICC4958
Repeat Motif(AG)5n(TA)18
Primer 1CaM1515.Forward primer: GCAATGAGAAGGGAAGGAAA
Primer 2CaM1515.Reverse primer: GCGGAAAACCAATTTACCAA
Product Length247
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankEI879617
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerCaM1515.Forward primerCicer arietinumprimer
Reverse primerCaM1515.Reverse primerCicer arietinumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CaM1515CaM1515Cicer arietinummarker_locus


Germplasm
Stock NameType
ICC4958cultivar
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-C214xILC3279-F2LG3N/A0CaM1515View
2chickpea-ICC4958xPI489777-RIL-F10LG3N/A30.19CaM1515View
3chickpea-ICCV96029×CDCFrontier-F2-2017CaLG03N/A3.6CaM1515View
4chickpea-BGD132×CDCFrontier-F2-2017CaLG03N/A4.6CaM1515View
5chickpea-ICC16641×CDCFrontier-F2-2017CaLG03N/A4.8CaM1515View
6chickpea-flowering_time_consensus_map-F2-2017CaLG03N/A13.7CaM1515View