CaSSR1, CaSSR1 (genetic_marker) Cicer arietinum

Name	CaSSR1
Genbank ID	Forward Primer
Type	STMS
Species	Cicer arietinum
Germplasm	Pusa362
Repeat Motif	(GA)3(CAA)2CG(TA)2(TAA)2
Primer 1	CaSSR1.Forward primer: TCAAAGGCAGACGTGTAGAA
Primer 2	CaSSR1.Reverse primer: TAGAGGAAGATTTCGGAGGA
Product Length	233
Publication	[view all]

Database	Accession
DB:genbank	Forward Primer

Year	Publication
2006	Choudhary S, Sethy NK, Shokeen B, Bhatia S. Development of sequence-tagged microsatellite site markers for chickpea (Cicer arietinum L.) Molecular Ecology Notes 2006 6(1):93–95.
2015	Das S, Upadhyaya HD, Bajaj D, Kujur A, Badoni S, Kumar LV, Tripathi S, Gowda CLL, Sharma S, Singh S, Tyagi AK, Parida SK. Deploying QTL-seq for rapid delineation of a potential candidate gene underlying major trait-associated QTL in chickpea. 2015; 22(3):193-203.

Stock Name	Type
Pusa362	accession

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Chickpea-ICC718xICC15061-F4	CaLG (Chr01)	N/A	2.2	CaSSR1 (TA113)	View