|
|
Marker Overview
| Name | CaSSR2 |
|---|
| Genbank ID | Forward Primer |
|---|
| Type | STMS |
|---|
| Species | Cicer arietinum |
|---|
| Germplasm | Pusa362 |
|---|
| Repeat Motif | (GAAT)4(GTAT)2 |
|---|
| Primer 1 | CaSSR2.Forward primer: GCCTACATTGCTTTCCCTTT |
|---|
| Primer 2 | CaSSR2.Reverse primer: TCATGTGTGTATGAAGTGGAATGA |
|---|
| Product Length | 244 |
|---|
| Publication | [view all] |
|---|
References
External references for this genetic_marker
| Database | Accession |
|---|
| DB:genbank | Forward Primer |
Publications
| Year | Publication |
|---|
| 2006 | Choudhary S, Sethy NK, Shokeen B, Bhatia S. Development of sequence-tagged microsatellite site markers for chickpea (Cicer arietinum L.) Molecular Ecology Notes 2006 6(1):93–95. |
| 2007 | Radhika P, Gowda SJM, Kadoo NY, Mhase LB, Jamadagni BM, Sainani MN, Chandra S, Gupta VS. Development of an integrated intraspecific map of chickpea (Cicer arietinum L.) using two recombinant inbred line populations. Theoretical and applied genetics TAG. 2007; 115(2):209-216. |
| 2015 | Das S, Upadhyaya HD, Bajaj D, Kujur A, Badoni S, Kumar LV, Tripathi S, Gowda CLL, Sharma S, Singh S, Tyagi AK, Parida SK. Deploying QTL-seq for rapid delineation of a potential candidate gene underlying major trait-associated QTL in chickpea. 2015; 22(3):193-203. |
|
