|
Marker Overview
Name | CaSSR7 |
Genbank ID | Forward Primer |
Type | STMS |
Species | Cicer arietinum |
Germplasm | Pusa362 |
Repeat Motif | (TA)2(GT)2(GA)2GTT(ATT)3 |
Primer 1 | CaSSR7.Forward primer: GCTCAAGGCTGAAGGAGATA |
Primer 2 | CaSSR7.Reverse primer: ACCCTGCAAGTCAAGTCTTC |
Product Length | 223 |
Publication | [view all] |
References
External references for this genetic_marker
Database | Accession |
DB:genbank | Forward Primer |
Publications
Year | Publication |
2006 | Choudhary S, Sethy NK, Shokeen B, Bhatia S. Development of sequence-tagged microsatellite site markers for chickpea (Cicer arietinum L.) Molecular Ecology Notes 2006 6(1):93–95. |
2015 | Das S, Upadhyaya HD, Bajaj D, Kujur A, Badoni S, Kumar LV, Tripathi S, Gowda CLL, Sharma S, Singh S, Tyagi AK, Parida SK. Deploying QTL-seq for rapid delineation of a potential candidate gene underlying major trait-associated QTL in chickpea. 2015; 22(3):193-203. |
|