CaSTMS22, CaSTMS22 (genetic_marker) Cicer arietinum

Marker Overview
NameCaSTMS22
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(CT)23
Primer 1CaSTMS22.Forward primer: CTCTTCCTCCTCGAGATC
Primer 2CaSTMS22.Reverse primer: ATAGATACAATACTCTGTGAGTTGG
Product Length157
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerCaSTMS22.Forward primerCicer arietinumprimer
Reverse primerCaSTMS22.Reverse primerCicer arietinumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Days to first flowerqDFFL.ILC3279xICCV2.LG3Cicer arietinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CaSTMS22CaSTMS22Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-ICCV2xJG62-F10-RILLG6AN/A19CaSTMS22View
2chickpea-ICCV96029xCDCFrontier-F2LG5N/A21.2CaSTMS22View
3chickpea-ILC3279xICCV2-F3LG3N/A24CaSTMS22View
4chickpea-ILC3279xICCV2-F3LG5N/A11.1CaSTMS22View
5chickpea-VijayxICC4958-RIL-2011LG1aN/A62.7CaSTMS22View
6chickpea-ICC4958xPI489777-RIL-F10LG5N/A29.7CaSTMS22View
7chickpea-ICCV96029xCDCFrontier-F2-2007LG5N/A21.1CaSTMS22View
8chickpea-HadasxCr205-F2LG5B-1N/A13.7CaSTMS22View
9chickpea-ICC4958xPI489777-RIL-F10-2012LG05N/A29.5CaSTMS22View
10chickpea-S95362xHowzat-F6-RILLG1.1/5N/A174.2CaSTMS22View
11chickpea-ICC4958xPI489777-RIL-2010LG5N/A369.8CaSTMS22View