|
|
Marker Overview
| Name | CaSTMS28 |
|---|
| Genbank ID | N/A |
|---|
| Type | STMS |
|---|
| Species | Cicer arietinum |
|---|
| Germplasm | ILC3279 |
|---|
| Repeat Motif | long imperfect ATT repeat |
|---|
| Primer 1 | CaSTMS28.Forward primer: CCCTTCTAGTGATATTTTG |
|---|
| Primer 2 | CaSTMS28.Reverse primer: AAATGTGTTTTATGGAATAAGTCAT |
|---|
| Product Length | 259 |
|---|
| Publication | [view all] |
|---|
Publications
| Year | Publication |
|---|
| 1999 | Huttel B, Winter P, Weising K, Choumane W, Weigand F, Kahl G. Sequence-tagged microsatellite site markers for chickpea (Cicer arietinum L.). Genome. 1999; 42:210-217. |
| 2000 | Winter P, Benko-Iseppon A, Huttel B, Ratnaparkhe M, Tullu A, Sonnante G, Pfaff T, Tekeoglu M, Santra D, Sant V. A linkage map of the chickpea (Cicer arietinum L.) genome based on recombinant inbred lines from a C. arietinum x C. reticulatum cross: localization of resistance genes for fusarium wilt races 4 and 5. Theoretical and applied genetics. 2000 Nov; 101(7):1155-1163. |
|
