CaTMS1110, CaTMS1110 (genetic_marker) Cicer sp. | PulseDB

Marker Overview

Marker Overview


Name	CaTMS1110
Genbank ID	N/A
Type	SSR
Species	Cicer sp.
Repeat Motif	(AGA)13
Primer 1	CaTMS1110.Forward primer: TTCTTCAAAACCTTCTTTCCCA
Primer 2	CaTMS1110.Reverse primer: AGCAGTTTAAGTCCGCTCCC
Product Length	262
Publication	[view all]

Publications


Year	Publication
2015	Khajuria YP, Saxena MS, Gaur R, Chattopadhyay D, Jain M, Parida SK, Bhatia S. Development and Integration of Genome-Wide Polymorphic Microsatellite Markers onto a Reference Linkage Map for Constructing a High-Density Genetic Map of Chickpea. PloS one. 2015; 10(5):e0125583.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xPI489777-RIL-2015	LG2	N/A	60	CaTMS1110	View
2	chickpea-ICC4958xPI489777-RIL-2015-2	LG1	N/A	19.23	CaTMS1110	View
3	Chickpea-ICC4958/PI489777-RIL-2020	LG01	N/A	19.23	CaTMS1110	View