CaTMS928, CaTMS928 (genetic_marker) Cicer sp. | PulseDB

Marker Overview

Marker Overview


Name	CaTMS928
Genbank ID	N/A
Type	SSR
Species	Cicer sp.
Repeat Motif	(AAT)25
Primer 1	CaTMS928.Forward primer: TTTCAAGTTTGGGGAGTTGG
Primer 2	CaTMS928.Reverse primer: TTTGCACACATTGTTGTTTGTC
Product Length	258
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Ca8	chromosome	Ca8:13504426..13504674 .

Publications


Year	Publication
2015	Khajuria YP, Saxena MS, Gaur R, Chattopadhyay D, Jain M, Parida SK, Bhatia S. Development and Integration of Genome-Wide Polymorphic Microsatellite Markers onto a Reference Linkage Map for Constructing a High-Density Genetic Map of Chickpea. PloS one. 2015; 10(5):e0125583.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xPI489777-RIL-2015	LG2	N/A	60	CaTMS928	View
2	chickpea-ICC4958xPI489777-RIL-2015-2	LG1	N/A	19.24	CaTMS928	View
3	Chickpea-ICC4958/PI489777-RIL-2020	LG01	N/A	19.24	CaTMS928	View