FENR, FENR (genetic_marker) Cicer sp.

Marker Overview
NameFENR
Genbank IDAW127593
TypeCAPS
SpeciesCicer sp.
Primer 1FENR.Forward primer: ATGCTTATGCCAAAAGATCCAAATGC
Primer 2FENR.Reverse primer: CTCACAGCAAAGTCGAGCCTGAAGT
Restriction EnzymeHph I
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankAW127593
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerFENR.Forward primerCicer sp.primer
Reverse primerFENR.Reverse primerCicer sp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
FENRFENRCicer sp.marker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Lupin-83A:476/P27255-RIL-2017LG06N/A36.2FENRView
2Lupin-83A:476/P27255-RILLG06N/A11.3FENRView
3Pea-Integrated_Map-Sudheesh-2015LG1N/A66.8FENRView
4Pea-JI1491_x_Cameor-RILLG1N/A84FENRView
5Pea-Attika_x_Isard-RIL-2016LGIN/A126.2FENRView
6Pea-Kaspa_x_Attika-RIL-2016LGIN/A89.8FENRView
7Pea-Consensus_RIL-2016LGIN/A105.3FENRView