GA13, GA13 (genetic_marker) Cicer arietinum

Name	GA13
Genbank ID	N/A
Type	STMS
Species	Cicer arietinum
Germplasm	ILC3279
Repeat Motif	(CT)16(CA)11
Primer 1	GA13.Forward primer: GGGCTCATTTACAGGTTACA
Primer 2	GA13.Reverse primer: TCAAAGATAATATAAAAGGATGAA
Product Length	123
Publication	[view all]

Year	Publication
1999	Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101.

Stock Name	Type
ILC3279	accession

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xPI489777-RIL-2012	LG3	N/A	137	GA13	View
2	chickpea-ICC4958xPI489777-RIL-2012-2	LG3	N/A	123.3	GA13	View
3	chickpea-HadasxCr205-F2	LG3B	N/A	1.2	GA13	View
4	chickpea-ILC72xCr5-10-RIL-2006	LG3	N/A	23.7	GA13	View
5	chickpea-ICC4958xPI489777-RIL-2010	LG3	N/A	121.5	GA13	View
6	chickpea-ICC4958xPI489777-RIL-2015-2	LG3	N/A	86.48	GA13	View
7	Chickpea-RIP12-Ortega	LG03-2	N/A	14.1	GA13	View
8	Chickpea-ICC4958/PI489777-RIL-2020	LG03	N/A	121.6	GA13	View