GA16, GA16 (genetic_marker) Cicer arietinum

Marker Overview
Genbank IDN/A
SpeciesCicer arietinum
Repeat Motif(GA)22
Primer 1GA16.Forward primer: CACCTCGTACCATGGTTTCTG
Primer 2GA16.Reverse primer: TAAATTTCATCCTCTCCGGC
Product Length247
Publication[view all]

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
GA16.Forward primerGA16.Forward primerCicer arietinumprimer
GA16.Reverse primerGA16.Reverse primerCicer arietinumprimer

This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Ascochyta blight resistanceqABR.P1359075xFLIP84-92C.LG2A6BCicer arietinumQTL
Ascochyta blight resistanceqABR.P1359075xFLIP84-92C.LG2A6B.2Cicer arietinumQTL
Ascochyta blight resistanceqABR.ILC1272xILC3279.LG2.ar1Cicer arietinumQTL
Ascochyta blight resistanceqABR.ILC1272xILC3279.LG2.ar2aCicer arietinumQTL

This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Days to 50% floweringqDFTFL.ILC588xILC3279.LGU.TH-cont10Cicer arietinumQTL
Ascochyta blight resistanceqABR.ILC72xCr5-10.LG2.2014Cicer sp.QTL

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
GA16GA16Cicer arietinummarker_locus

Stock NameType
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
21Chickpea-ICC4958× ICC1882-RILCaLG02N/A67.73GA16View