GA16, GA16 (genetic_marker) Cicer arietinum

Marker Overview


Name	GA16
Genbank ID	N/A
Type	STMS
Species	Cicer arietinum
Germplasm	ILC3279
Repeat Motif	(GA)22
Primer 1	GA16.Forward primer: CACCTCGTACCATGGTTTCTG
Primer 2	GA16.Reverse primer: TAAATTTCATCCTCTCCGGC
Product Length	247
Publication	[view all]

Relationships

This genetic_marker is adjacent to the following primer feature(s):


Feature Name	Unique Name	Species	Type
GA16.Forward primer	GA16.Forward primer	Cicer arietinum	primer
GA16.Reverse primer	GA16.Reverse primer	Cicer arietinum	primer

This genetic_marker is adjacent to the following QTL feature(s):


Feature Name	Unique Name	Species	Type
Ascochyta blight resistance	qABR.P1359075xFLIP84-92C.LG2A6B	Cicer arietinum	QTL
Ascochyta blight resistance	qABR.P1359075xFLIP84-92C.LG2A6B.2	Cicer arietinum	QTL
Ascochyta blight resistance	qABR.ILC1272xILC3279.LG2.ar1	Cicer arietinum	QTL
Ascochyta blight resistance	qABR.ILC1272xILC3279.LG2.ar2a	Cicer arietinum	QTL

This genetic_marker is located in the following QTL feature(s):


Feature Name	Unique Name	Species	Type
Days to 50% flowering	qDFTFL.ILC588xILC3279.LGU.TH-cont10	Cicer arietinum	QTL
Ascochyta blight resistance	qABR.ILC72xCr5-10.LG2.2014	Cicer sp.	QTL

The following marker_locus feature(s) are an instance of this genetic_marker:


Feature Name	Unique Name	Species	Type
GA16	GA16	Cicer arietinum	marker_locus

Publications


Year	Publication
1999	Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101.
2013	Sabbavarapu MM, Sharma M, Chamarthi SK, Swapna N, Rathore A, Thudi M, Gaur PM, Pande S, Singh S, Kaur L, Varshney RK. Molecular mapping of QTLs for resistance to Fusarium wilt (race 1) and Ascochyta blight in chickpea (Cicer arietinum L.). Euphytica. 2013; 193(1):121-133.
2014	Patil B, Ravikumar R, Bhat J, Soregaon C. Molecular mapping of QTLs for resistance to early and late Fusarium wilt in chickpea. Czech journal of genetics and plant breeding. 2014; 50(2):171-176.
2015	Gupta S, Kumar T, Verma S, Bharadwaj C, Bhatia S. Development of gene-based markers for use in construction of the chickpea (Cicer arietinum L.) genetic linkage map and identification of QTLs associated with seed weight and plant height. 2015 Oct 7.

Germplasm


Stock Name	Type
ILC3279	breeding_research_material

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Chickpea-SBD377/BGD112-RIL-High_density	LG02	N/A	74.17	GA16	View
2	Chickpea-RIP8-Ortega	LG02-1	N/A	28.8	GA16	View
3	Chickpea-RIP5-Ortega	LG02	N/A	2.5	GA16	View
4	chickpea-C214xILC3279-F2	LG2	N/A	3.8	GA16	View
5	chickpea-C214xWR315-F2	LG2	N/A	0	GA16	View
6	chickpea-ICC4991xICCV04516-F2	LG2	N/A	34.6	GA16	View
7	chickpea-ICC4958xPI489777-RIL-2012	LG2	N/A	118.7	GA16	View
8	chickpea-ICC4958xPI489777-RIL-2012-2	LG2	N/A	96.4	GA16	View
9	chickpea-ICC4958xPI489777-RIL-F10	LG2	N/A	27.74	GA16	View
10	chickpea-ILC3279xWR315-RIL-2007	LG2	N/A	61.5	GA16	View
11	chickpea-ICC4958xPI489777-RIL-F10-2012	LG02	N/A	29.3	GA16	View
12	chickpea-ILC72xCr5-10-RIL-2014	LG2	N/A	194.3	GA16	View
13	chickpea-ILC588xILC3279-RIL-F6	LG2	N/A	20.7	GA16	View
14	chickpea-ICC4958xPI489777-RIL-2010	LG2	N/A	0	GA16	View
15	chickpea-ICC4958xPI489777-RIL-2015-2	LG2	N/A	50.83	GA16	View
16	chickpea-ICC5810×CDCFrontier-F2-2017	CaLG02	N/A	0	GA16	View
17	chickpea-ICC16641×CDCFrontier-F2-2017	CaLG02	N/A	0	GA16	View
18	chickpea-flowering_time_consensus_map-F2-2017	CaLG02	N/A	0	GA16	View
19	Chickpea-JG62_X_WR315-RIL	LG1	N/A	0	GA16	View
20	Chickpea-JG62_X_WR315-RIL	LG2	N/A	83.6	GA16	View
21	Chickpea-ICC4958× ICC1882-RIL	CaLG02	N/A	67.73	GA16	View
22	Chickpea_SBD377_X_BGD112_RIL	LG3	N/A	0	GA16	View