GA8, GA8 (genetic_marker) Cicer arietinum

Name	GA8
Genbank ID	N/A
Type	STMS
Species	Cicer arietinum
Germplasm	ILC3279
Repeat Motif	(CT)9
Primer 1	GA8.Forward primer: GCTCTAAAGGGAAGGCGATT
Primer 2	GA8.Reverse primer: AACCACCAAAGTTCCCCAG
Product Length	161
Publication	[view all]

Year	Publication
1999	Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101.

Stock Name	Type
ILC3279	accession