GAA40, GAA40 (genetic_marker) Cicer arietinum

Name	GAA40
Genbank ID	N/A
Type	STMS
Species	Cicer arietinum
Germplasm	ILC3279
Repeat Motif	(CTT)9
Primer 1	GAA40.Forward primer: TTGACGCAGAGAACTCTCAA
Primer 2	GAA40.Reverse primer: ATTGGTGTGATGGGTGGATT
Product Length	245
Publication	[view all]

Year	Publication
1999	Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101.

Stock Name	Type
ILC3279	accession

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICCV96029xCDCCorinne-F2	LG1	N/A	6.1	GAA40	View
2	chickpea-ICCV96029xCDCFrontier-F2	LG1	N/A	4.7	GAA40	View
3	chickpea-ICC4958xPI489777-RIL-2012	LG1	N/A	142	GAA40	View
4	chickpea-ICC4958xPI489777-RIL-2012-2	LG1	N/A	126.6	GAA40	View
5	chickpea-ICC4958xPI489777-RIL-F10	LG1	N/A	65.92	GAA40	View
6	chickpea-ICCV96029xCDCFrontier-F2-2007	LG1	N/A	4.7	GAA40	View
7	chickpea-HadasxICC5810-RIL	LG1	N/A	30.6	GAA40	View
8	chickpea-HadasxCr205-F2	LG1B	N/A	12.1	GAA40	View
9	chickpea-ICC4958xPI489777-RIL-F10-2012	LG01	N/A	48.91	GAA40	View
10	chickpea-ICC4958xPI489777-RIL-2010	LG1	N/A	367.3	GAA40	View
11	chickpea-ICC4958xPI489777-RIL-2015-2	LG1	N/A	21.63	GAA40	View
12	Chickpea-ICC4958/PI489777-RIL-2020	LG01	N/A	61.76	GAA40	View