GAA47, GAA47 (genetic_marker) Cicer arietinum

Name	GAA47
Genbank ID	N/A
Type	STMS
Species	Cicer arietinum
Germplasm	ILC3279
Repeat Motif	(GAA)11
Primer 1	GAA47.Forward primer: CACTCCTCATGCCAACTCCT
Primer 2	GAA47.Reverse primer: AAAATGGAATAGTCGTATGGGG
Product Length	169
Publication	[view all]

Year	Publication
1999	Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101.
2013	Sabbavarapu MM, Sharma M, Chamarthi SK, Swapna N, Rathore A, Thudi M, Gaur PM, Pande S, Singh S, Kaur L, Varshney RK. Molecular mapping of QTLs for resistance to Fusarium wilt (race 1) and Ascochyta blight in chickpea (Cicer arietinum L.). Euphytica. 2013; 193(1):121-133.
2015	Gupta S, Kumar T, Verma S, Bharadwaj C, Bhatia S. Development of gene-based markers for use in construction of the chickpea (Cicer arietinum L.) genetic linkage map and identification of QTLs associated with seed weight and plant height. 2015 Oct 7.

Stock Name	Type
ILC3279	accession

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-C214xILC3279-F2	LG4	N/A	0	GAA47	View
2	chickpea-ICCV96029xAmit-F2	LG4	N/A	0	GAA47	View
3	chickpea-ICCV96029xCDCFrontier-F2	LG4	N/A	45.7	GAA47	View
4	chickpea-ICCV96029xCDCLuna-F2	LG4	N/A	28.3	GAA47	View
5	chickpea-ILC3279xICCV2-F3	LG4	N/A	13.3	GAA47	View
6	chickpea-ICC4958xPI489777-RIL-2012	LG4	N/A	100.6	GAA47	View
7	chickpea-ICCV2xJG62-RIL-F10-2011	LGVI	N/A	60.9	GAA47	View
8	chickpea-ICC4958xPI489777-RIL-2012-2	LG4	N/A	113.8	GAA47	View
9	chickpea-ICC4958xPI489777-RIL-F10	LG4	N/A	27.69	GAA47	View
10	chickpea-ICCV96029xCDCFrontier-F2-2007	LG4	N/A	45.7	GAA47	View
11	chickpea-ILC3279xWR315-RIL	LG4a	N/A	22.6	GAA47	View
12	chickpea-ILC72xCr5-10-RIL-2006	LG4	N/A	19.7	GAA47	View
13	chickpea-ICC4958xPI489777-RIL-F10-2012	LG04	N/A	80.01	GAA47	View
14	chickpea-ICC4958xPI489777-RIL-2010	LG4	N/A	118	GAA47	View
15	chickpea-ICC4958xPI489777-RIL-2015-2	LG4	N/A	91.88	GAA47	View
16	chickpea-ICCV96029×CDCFrontier-F2-2017	CaLG04	N/A	40.9	GAA47	View
17	chickpea-ICC5810×CDCFrontier-F2-2017	CaLG04	N/A	55.9	GAA47	View
18	chickpea-ICC16641×CDCFrontier-F2-2017	CaLG04	N/A	44.5	GAA47	View
19	chickpea-flowering_time_consensus_map-F2-2017	CaLG04	N/A	49.7	GAA47	View
20	Chickpea-ICCL81001_x_Cr5-9-RIL	LG4	N/A	46.9	GAA47	View
21	Chickpea_SBD377_X_BGD112_RIL	LG6	N/A	98.4	GAA47	View
22	Chickpea-RIP12-Ortega	LG04	N/A	14.2	GAA47	View
23	Chickpea-RIP5-Ortega	LG04-1	N/A	0	GAA47	View
24	Chickpea-RIP8-Ortega	LG04-1	N/A	2.3	GAA47	View
25	Chickpea-SBD377/BGD112-RIL-High_density	LG02	N/A	53.3	GAA47	View
26	Chickpea-ICC4958/PI489777-RIL-2020	LG04	N/A	152.25	GAA47	View