H1D221, H1D221 (genetic_marker) Cicer arietinum | PulseDB

Marker Overview

Marker Overview


Name	H1D221
Genbank ID	N/A
Type	SSR
Species	Cicer arietinum
Germplasm	Hadas
Repeat Motif	(TAA)25 CAA (TAA)23 537 bp (TAA)4
Primer 1	H1D221.Forward primer: TTCTAGAAACTGTCGACTGATAG
Primer 2	H1D221.Reverse primer: ACTTAATCCATGAAATTTGTTTT
Product Length	238
Publication	[view all]

Publications


Year	Publication
2005	Lichtenzveig J, Scheuring C, Dodge J, Abbo S, Zhang HB. Construction of BAC and BIBAC libraries and their applications for generation of SSR markers for genome analysis of chickpea, Cicer arietinum L. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Feb; 110(3):492-510.

Germplasm


Stock Name	Type
Hadas	accession

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-JG62xVijay-VijayxICC4958-RIL	LG4	N/A	37.8	H1D221	View
2	chickpea-VijayxICC4958-RIL-2011	LG4	N/A	22.1	H1D221	View
3	chickpea-ICCV2xJG62-RIL-F10-2011	LGVI	N/A	55.4	H1D221	View
4	chickpea-ICC3996xILWC184-F2	LG6	N/A	40.7	H1D221	View
5	chickpea-ILC588xILC3279-RIL-F6	LG6	N/A	0	H1D221	View