H1F21, H1F21 (genetic_marker) Cicer arietinum

Name	H1F21
Genbank ID	N/A
Type	SSR
Species	Cicer arietinum
Germplasm	Hadas
Repeat Motif	(TAA)20
Primer 1	H1F21.Forward primer: GAGGCGAGAAGAAGGAAGAG
Primer 2	H1F21.Reverse primer: GGGAAAGTCTTGCTCCTACG
Product Length	316
Publication	[view all]
Contact	Vincent Vadez

Name	Details
Vincent Vadez	First name: Vincent Last name: Vadez Title: Researcher Institution: International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) Address: International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Patancheru, Andhra Pradesh 502 324, India Country: India Email: v.vadez@cgiar.org

Year	Publication
2005	Lichtenzveig J, Scheuring C, Dodge J, Abbo S, Zhang HB. Construction of BAC and BIBAC libraries and their applications for generation of SSR markers for genome analysis of chickpea, Cicer arietinum L. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Feb; 110(3):492-510.
2018	Sivasakthi K, Thudi M, Tharanya M, Kale SM, Kholová J, Halime MH, Jaganathan D, Baddam R, Thirunalasundari T, Gaur PM, Varshney RK, Vadez V. Plant vigour QTLs co-map with an earlier reported QTL hotspot for drought tolerance while water saving QTLs map in other regions of the chickpea genome. BMC plant biology. 2018 Feb 06; 18(1):29.

Stock Name	Type
Hadas	accession

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICCV96029xAmit-F2	LG6	N/A	72.4	H1F21	View
2	chickpea-ICCV96029xCDCCorinne-F2	LG6	N/A	51.1	H1F21	View
3	chickpea-ICCV96029xCDCFrontier-F2	LG6	N/A	75.6	H1F21	View
4	chickpea-ICCV96029xCDCLuna-F2	LG6	N/A	34.7	H1F21	View
5	chickpea-ICCV96029xCDCFrontier-F2-2007	LG6	N/A	75.6	H1F21	View
6	chickpea-ICC3996xILWC184-F2	LG6	N/A	40.7	H1F21	View
7	Chickpea-ICC4958_x_ICC1882-RIL-2018	CaLG06	N/A	37.49	H1F21	View
8	Chickpea-ICC4958× ICC1882-RIL	CaLG06	N/A	7.1	H1F21	View