H1J04, H1J04 (genetic_marker) Cicer arietinum | PulseDB

Marker Overview

Marker Overview


Name	H1J04
Genbank ID	N/A
Type	SSR
Species	Cicer arietinum
Germplasm	Hadas
Repeat Motif	(GA)16
Primer 1	H1J04.Forward primer: TTAGTTGGGCACAACAGGAC
Primer 2	H1J04.Reverse primer: AGGGGGAGGATGTCCTTAAC
Product Length	157
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Ca2	chromosome	Ca2:22549646..22549802 .
chr2	chromosome	chr2:22549646..22549802 .

Publications


Year	Publication
2005	Lichtenzveig J, Scheuring C, Dodge J, Abbo S, Zhang HB. Construction of BAC and BIBAC libraries and their applications for generation of SSR markers for genome analysis of chickpea, Cicer arietinum L. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Feb; 110(3):492-510.

Germplasm


Stock Name	Type
Hadas	accession

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC3996xILWC184-F2	LG2	N/A	1	H1J04	View