|
Marker Overview
Name | H2B061 |
Genbank ID | N/A |
Type | SSR |
Species | Cicer arietinum |
Germplasm | Hadas |
Repeat Motif | (GAA)2 G (GAA)19 70 bp (TA)7 14 bp (TA)11 |
Primer 1 | H2B061.Forward primer: TCTTGAAGCAAAAGAAGTCAAAAG |
Primer 2 | H2B061.Reverse primer: CAAGTGATAAGTAGGAAGGCAGAA |
Product Length | 163 |
Publication | [view all] |
Publications
Year | Publication |
2005 | Lichtenzveig J, Scheuring C, Dodge J, Abbo S, Zhang HB. Construction of BAC and BIBAC libraries and their applications for generation of SSR markers for genome analysis of chickpea, Cicer arietinum L. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Feb; 110(3):492-510. |
2013 | Sabbavarapu MM, Sharma M, Chamarthi SK, Swapna N, Rathore A, Thudi M, Gaur PM, Pande S, Singh S, Kaur L, Varshney RK. Molecular mapping of QTLs for resistance to Fusarium wilt (race 1) and Ascochyta blight in chickpea (Cicer arietinum L.). Euphytica. 2013; 193(1):121-133. |
Germplasm
Stock Name | Type |
Hadas | accession |
|