H3D05, H3D05 (genetic_marker) Cicer arietinum

Marker Overview
NameH3D05
Genbank IDN/A
TypeSSR
SpeciesCicer arietinum
GermplasmHadas
Repeat Motif(TAA)41
Primer 1H3D05.Forward primer: AGACGTGTTCCCTTTCTTTTAACTA
Primer 2H3D05.Reverse primer: GCCGACACAAAGTTTATGATTTT
Product Length307
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerH3D05.Forward primerCicer arietinumprimer
Reverse primerH3D05.Reverse primerCicer arietinumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
H3D05H3D05Cicer arietinummarker_locus


Germplasm
Stock NameType
Hadascultivar