H3F09, H3F09 (genetic_marker) Cicer arietinum

Marker Overview
NameH3F09
Genbank IDN/A
TypeSSR
SpeciesCicer arietinum
GermplasmHadas
Repeat Motif(TTA)44
Primer 1H3F09.Forward primer: AGCATGTAGTAGGAGGCAAGTATG
Primer 2H3F09.Reverse primer: GTAGGTTCCCGCTACATTACTTTTA
Product Length241
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerH3F09.Forward primerCicer arietinumprimer
Reverse primerH3F09.Reverse primerCicer arietinumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
H3F09H3F09Cicer arietinummarker_locus


Germplasm
Stock NameType
Hadascultivar