H3H021, H3H021 (genetic_marker) Cicer arietinum

Marker Overview
NameH3H021
Genbank IDN/A
TypeSSR
SpeciesCicer arietinum
GermplasmHadas
Repeat Motif(GA)8 235 bp (CAAA)3 25 bp (TC)11 25 bp (TTTC)3 (TC)4
Primer 1H3H021.Forward primer: GGGGTAAAAACTGTCCCTTTTA
Primer 2H3H021.Reverse primer: TCCTTTCCTGTCTTCATCTCTG
Product Length182
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerH3H021.Forward primerCicer arietinumprimer
Reverse primerH3H021.Reverse primerCicer arietinumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
H3H021H3H021Cicer arietinummarker_locus


Germplasm
Stock NameType
Hadascultivar
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-ICC4958xPI489777-RIL-2011LG1N/A41.9H3H021View
2chickpea-ICC4958xPI489777-RIL-2012LG1N/A110.7H3H021View
3chickpea-ICC4958xPI489777-RIL-2012-2LG8N/A185.5H3H021View
4chickpea-ICC4958xPI489777-RIL-F10LG1N/A42.75H3H021View
5chickpea-ICC4958xPI489777-RIL-F10-2012LG01N/A66.73H3H021View
6chickpea-ICC4958xPI489777-RIL-2010LG1N/A104.1H3H021View
7chickpea-ICC4958xPI489777-RIL-2015-2LG1N/A16.17H3H021View
8Chickpea-ICC4958/PI489777-RIL-2020LG01N/A16.17H3H021View