H3H022, H3H022 (genetic_marker) Cicer arietinum | PulseDB

Marker Overview

Marker Overview


Name	H3H022
Genbank ID	N/A
Type	SSR
Species	Cicer arietinum
Germplasm	Hadas
Repeat Motif	(GA)8 235 bp (CAAA)3 25 bp (TC)11 25 bp (TTTC)3 (TC)4
Primer 1	H3H022.Forward primer: TTGAGTTAAGGAAGCAGACAGC
Primer 2	H3H022.Reverse primer: CACCCTAAAGTTGTCCAATCAA
Product Length	197
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Ca1	chromosome	Ca1:41855204..41855400 .
chr1	chromosome	chr1:41855204..41855400 .

Publications


Year	Publication
2005	Lichtenzveig J, Scheuring C, Dodge J, Abbo S, Zhang HB. Construction of BAC and BIBAC libraries and their applications for generation of SSR markers for genome analysis of chickpea, Cicer arietinum L. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Feb; 110(3):492-510.

Germplasm


Stock Name	Type
Hadas	accession

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xPI489777-RIL-2012	LG1	N/A	94.8	H3H022	View
2	chickpea-ICC4958xPI489777-RIL-2012-2	LG7	N/A	42.9	H3H022	View
3	chickpea-ICC4958xPI489777-RIL-2015-2	LG8	N/A	88.42	H3H022	View
4	Chickpea-ICC4958/PI489777-RIL-2020	LG08	N/A	163.38	H3H022	View