H4A04, H4A04 (genetic_marker) Cicer arietinum

Marker Overview
NameH4A04
Genbank IDN/A
TypeSSR
SpeciesCicer arietinum
GermplasmHadas
Repeat Motif(TTA)32
Primer 1H4A04.Forward primer: GCAAATTCTCACCATTTCTTTTT
Primer 2H4A04.Reverse primer: TGTTTTGACGAATGAGAAGTAAAGA
Product Length240
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerH4A04.Forward primerCicer arietinumprimer
Reverse primerH4A04.Reverse primerCicer arietinumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
H4A04H4A04Cicer arietinummarker_locus


Germplasm
Stock NameType
Hadascultivar