H4B09, H4B09 (genetic_marker) Cicer arietinum

Marker Overview
NameH4B09
Genbank IDN/A
TypeSSR
SpeciesCicer arietinum
GermplasmHadas
Repeat Motif(TAA)37
Primer 1H4B09.Forward primer: GATACAAAAGATGGGAACTTGAGAT
Primer 2H4B09.Reverse primer: GAGAGAAAAGCTTGTTCAAGTTAGA
Product Length218
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerH4B09.Forward primerCicer arietinumprimer
Reverse primerH4B09.Reverse primerCicer arietinumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
H4B09H4B09Cicer arietinummarker_locus


Germplasm
Stock NameType
Hadascultivar
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-ICCV96029xCDCCorinne-F2LG2N/A54.1H4B09View
2chickpea-ICCV96029xCDCFrontier-F2LG2N/A32.8H4B09View
3chickpea-ICCV96029xCDCLuna-F2LG2N/A15.2H4B09View
4chickpea-ICCV96029xCDCFrontier-F2-2007LG2N/A32.8H4B09View
5chickpea-HadasxICC5810-RILLG2N/A36.7H4B09View
6chickpea-ILC588xILC3279-RIL-F6LG2N/A0H4B09View