H4D08, H4D08 (genetic_marker) Cicer arietinum

Marker Overview
NameH4D08
Genbank IDN/A
TypeSSR
SpeciesCicer arietinum
GermplasmHadas
Repeat Motif(TAA)4 9 bp (TAA)25
Primer 1H4D08.Forward primer: TGTCCTTTATTTCTTAAGCACACAT
Primer 2H4D08.Reverse primer: GAGATGGATGTTATTGGACTCATC
Product Length189
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerH4D08.Forward primerCicer arietinumprimer
Reverse primerH4D08.Reverse primerCicer arietinumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
H4D08H4D08Cicer arietinummarker_locus


Germplasm
Stock NameType
Hadascultivar
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-HadasxICC5810-RILLG2N/A25.5H4D08View
2chickpea-ICC3996xILWC184-F2LG2N/A1H4D08View
3chickpea-ILC588xILC3279-RIL-F6LG2N/A3.6H4D08View
4chickpea-ICCV96029×CDCFrontier-F2-2017CaLG02N/A4.3H4D08View
5chickpea-ICC5810×CDCFrontier-F2-2017CaLG02N/A28.9H4D08View
6chickpea-BGD132×CDCFrontier-F2-2017CaLG02N/A3.3H4D08View
7chickpea-flowering_time_consensus_map-F2-2017CaLG02N/A28.6H4D08View