H4D11, H4D11 (genetic_marker) Cicer arietinum

Marker Overview
NameH4D11
Genbank IDN/A
TypeSSR
SpeciesCicer arietinum
GermplasmHadas
Repeat Motif(TAA)48 14 bp (TAA)3
Primer 1H4D11.Forward primer: TCTTATGCACACATTTATTCTGAAATC
Primer 2H4D11.Reverse primer: CATCTGTTAAAATATGGTTGCCTATAA
Product Length276
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerH4D11.Forward primerCicer arietinumprimer
Reverse primerH4D11.Reverse primerCicer arietinumprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Drought tolerance indexqDTI.ILC588xILC3279.LGU.TH-Dr08Cicer arietinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
H4D11H4D11Cicer arietinummarker_locus


Germplasm
Stock NameType
Hadascultivar
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-HadasxICC5810-RILLG2N/A25.5H4D11View
2chickpea-ILC588xILC3279-RIL-F6LG2N/A1.2H4D11View