H4E04, H4E04 (genetic_marker) Cicer arietinum

Marker Overview
NameH4E04
Genbank IDN/A
TypeSSR
SpeciesCicer arietinum
GermplasmHadas
Repeat Motif(TTA)56 (TTTA)3
Primer 1H4E04.Forward primer: ACTTTATGATGTAAAATATGCATGGTC
Primer 2H4E04.Reverse primer: TCTTTTGTTTTACTAATGCTCATGTCT
Product Length346
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerH4E04.Forward primerCicer arietinumprimer
Reverse primerH4E04.Reverse primerCicer arietinumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
H4E04H4E04Cicer arietinummarker_locus


Germplasm
Stock NameType
Hadascultivar
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-ILC588xILC3279-RIL-F6LG1N/A0.4H4E04View