|
Marker Overview
Name | H4G11 |
Genbank ID | N/A |
Type | SSR |
Species | Cicer arietinum |
Germplasm | Hadas |
Repeat Motif | (TAA)18 |
Primer 1 | H4G11.Forward primer: ATCTAAGTGAGCGGCTACTAAATCA |
Primer 2 | H4G11.Reverse primer: GTAGTCATGCAGCCTATAAAAACAA |
Product Length | 195 |
Publication | [view all] |
Contact | Vincent Vadez
|
Publications
Year | Publication |
2005 | Lichtenzveig J, Scheuring C, Dodge J, Abbo S, Zhang HB. Construction of BAC and BIBAC libraries and their applications for generation of SSR markers for genome analysis of chickpea, Cicer arietinum L. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Feb; 110(3):492-510. |
2018 | Sivasakthi K, Thudi M, Tharanya M, Kale SM, Kholová J, Halime MH, Jaganathan D, Baddam R, Thirunalasundari T, Gaur PM, Varshney RK, Vadez V. Plant vigour QTLs co-map with an earlier reported QTL hotspot for drought tolerance while water saving QTLs map in other regions of the chickpea genome. BMC plant biology. 2018 Feb 06; 18(1):29. |
2013 | Sabbavarapu MM, Sharma M, Chamarthi SK, Swapna N, Rathore A, Thudi M, Gaur PM, Pande S, Singh S, Kaur L, Varshney RK. Molecular mapping of QTLs for resistance to Fusarium wilt (race 1) and Ascochyta blight in chickpea (Cicer arietinum L.). Euphytica. 2013; 193(1):121-133. |
2007 | Radhika P, Gowda SJM, Kadoo NY, Mhase LB, Jamadagni BM, Sainani MN, Chandra S, Gupta VS. Development of an integrated intraspecific map of chickpea (Cicer arietinum L.) using two recombinant inbred line populations. Theoretical and applied genetics TAG. 2007; 115(2):209-216. |
Germplasm
Stock Name | Type |
Hadas | accession |
|