H5A08, H5A08 (genetic_marker) Cicer arietinum

Marker Overview
NameH5A08
AliasH5A08(180)
H5A08(250)
Genbank IDN/A
TypeSSR
SpeciesCicer arietinum
GermplasmHadas
Repeat Motif(TTA)18 CCA (TTA)8 TT (TTA)3
Primer 1H5A08.Forward primer: AGGAGAGAAAATGTAACATCCTAAATC
Primer 2H5A08.Reverse primer: CAAATTGGTTATTGATTACAATTAGGT
Product Length218
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerH5A08.Forward primerCicer arietinumprimer
Reverse primerH5A08.Reverse primerCicer arietinumprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Canopy temperature differentialqCTEMP.ILC588xILC3279.LG1.BR07.16WASCicer arietinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
H5A08H5A08Cicer arietinummarker_locus


Germplasm
Stock NameType
Hadascultivar
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-ICCV96029xCDCCorinne-F2LG2N/A53.2H5A08View
2chickpea-ICCV96029xCDCFrontier-F2LG1N/A42.5H5A08View
3chickpea-ICCV96029xCDCFrontier-F2LG5N/A55H5A08View
4chickpea-ICCV96029xCDCFrontier-F2-2007LG1N/A42.5H5A08View
5chickpea-ICCV96029xCDCFrontier-F2-2007LG5N/A55H5A08View
6chickpea-HadasxICC5810-RILLG2N/A27.4H5A08View
7chickpea-ILC588xILC3279-RIL-F6LG1N/A0H5A08View
8chickpea-ICCV96029×CDCFrontier-F2-2017CaLG02N/A5.3H5A08View
9chickpea-ICC5810×CDCFrontier-F2-2017CaLG02N/A28.8H5A08View
10chickpea-BGD132×CDCFrontier-F2-2017CaLG02N/A3.5H5A08View
11chickpea-ICC16641×CDCFrontier-F2-2017CaLG02N/A30.6H5A08View
12chickpea-flowering_time_consensus_map-F2-2017CaLG02N/A28.7H5A08View