H6C07, H6C07 (genetic_marker) Cicer arietinum

Marker Overview
NameH6C07
Genbank IDN/A
TypeSSR
SpeciesCicer arietinum
GermplasmHadas
Repeat Motif(GAT)3 (TAA)17 TCA (TAA)2 TCA (TAA)13TCA (TAA)5
Primer 1H6C07.Forward primer: CAAAAGTGCAATTAAGCCTACATAATA
Primer 2H6C07.Reverse primer: CCATTTTGTTTTAACACATATTTAACG
Product Length201
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
H6C07.Forward primerH6C07.Forward primerCicer arietinumprimer
Reverse primerH6C07.Reverse primerCicer arietinumprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Drought tolerance indexqDTI.ILC588xILC3279.LG3.TH-Dr08Cicer arietinumQTL
Drought tolerance indexqDTI.ILC588xILC3279.LG3.TH-Dr10Cicer arietinumQTL
Drought tolerance indexqDTI.ILC588xILC3279.LG3.TH-cont10Cicer arietinumQTL
Pod number per plantqPDPL.ILC588xILC3279.LG3.TH-Dr08Cicer arietinumQTL
Days to 50% floweringqDFTFL.ILC588xILC3279.LG3.Terbol-09Cicer arietinumQTL
Days to 50% floweringqDFTFL.ILC588xILC3279.LG3.Terbol-11Cicer arietinumQTL
Seed yield per plotqSYPLOT.ILC588xILC3279.LG3.TH-Dr08Cicer arietinumQTL
Seed yield per plotqSYPLOT.ILC588xILC3279.LG3.TH-Dr10Cicer arietinumQTL
Days to maturityqDM.ILC588xILC3279.LG3.TH-cont08Cicer arietinumQTL
Days to maturityqDM.ILC588xILC3279.LG3.TH-Dr08Cicer arietinumQTL
Days to maturityqDM.ILC588xILC3279.LG3.Terbol-09Cicer arietinumQTL
Days to maturityqDM.ILC588xILC3279.LG3.TH-cont09Cicer arietinumQTL
Days to maturityqDM.ILC588xILC3279.LG3.TH-cont10Cicer arietinumQTL
Days to maturityqDM.ILC588xILC3279.LG3.TH-Dr10Cicer arietinumQTL
Days to maturityqDM.ILC588xILC3279.LG3.Terbol-11Cicer arietinumQTL
Harvest indexqHI.ILC588xILC3279.LG3.TH-Dr08Cicer arietinumQTL
Harvest indexqHI.ILC588xILC3279.LG3.TH-cont10Cicer arietinumQTL
Harvest indexqHI.ILC588xILC3279.LG3.TH-Dr10Cicer arietinumQTL
Seed number per plantqSDPL.ILC588xILC3279.LG3.TH-Dr08Cicer arietinumQTL
Seed number per plantqSDPL.ILC588xILC3279.LG3.Terbol-11Cicer arietinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
H6C07H6C07Cicer arietinummarker_locus


Germplasm
Stock NameType
Hadascultivar
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-ILC588xILC3279-RILLG3N/A73.1H6C07View
2chickpea-ICC3996xILWC184-F2LG3N/A28.9H6C07View
3chickpea-ILC588xILC3279-RIL-F6LG3N/A0H6C07View