H6D11, H6D11 (genetic_marker) Cicer arietinum

Marker Overview
NameH6D11
Genbank IDN/A
TypeSSR
SpeciesCicer arietinum
GermplasmHadas
Repeat Motif(TAA)11
Primer 1H6D11.Forward primer: AAAGATGGGAACTTGAGATGTTG
Primer 2H6D11.Reverse primer: AATAGCTACTCAAGGCTGAAGAAA
Product Length200
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerH6D11.Forward primerCicer arietinumprimer
Reverse primerH6D11.Reverse primerCicer arietinumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
H6D11H6D11Cicer arietinummarker_locus


Germplasm
Stock NameType
Hadascultivar
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-HadasxICC5810-RILLG2N/A25H6D11View
2chickpea-ICC3996xILWC184-F2LG2N/A1H6D11View
3chickpea-ICCV96029×CDCFrontier-F2-2017CaLG02N/A5.9H6D11View
4chickpea-ICC5810×CDCFrontier-F2-2017CaLG02N/A28.9H6D11View
5chickpea-BGD132×CDCFrontier-F2-2017CaLG02N/A3.9H6D11View
6chickpea-flowering_time_consensus_map-F2-2017CaLG02N/A29.4H6D11View