|
Marker Overview
Name | ICCM0104 |
Genbank ID | FI856566 |
Type | SSR |
Species | Cicer arietinum |
Germplasm | ICC4958 |
Repeat Motif | (TTA)11 |
Primer 1 | ICCM0104.Forward primer: CCAAACCTCCAAAAATCTGC |
Primer 2 | ICCM0104.Reverse primer: TCATTTTTGATTCATTCTTGGG |
Product Length | 278 |
Publication | [view all] |
Contact | Vincent Vadez
|
References
External references for this genetic_marker
Database | Accession |
DB:genbank | FI856566 |
Publications
Year | Publication |
2010 | Nayak SN, Zhu H, Varghese N, Datta S, Choi H, Horres R, Jüngling R, Singh J, Kavi Kishor PB, Sivaramakrishnan S, Hoisington DA, Kahl G, Winter P, Cook DR, Varshney RK. Integration of novel SSR and gene-based SNP marker loci in the chickpea genetic map and establishment of new anchor points with Medicago truncatula genome. Theoretical and applied genetics TAG. 2010; 120(7):1415-1441. |
2018 | Sivasakthi K, Thudi M, Tharanya M, Kale SM, Kholová J, Halime MH, Jaganathan D, Baddam R, Thirunalasundari T, Gaur PM, Varshney RK, Vadez V. Plant vigour QTLs co-map with an earlier reported QTL hotspot for drought tolerance while water saving QTLs map in other regions of the chickpea genome. BMC plant biology. 2018 Feb 06; 18(1):29. |
|