ICCM0297, ICCM0297 (genetic_marker) Cicer arietinum

Marker Overview
NameICCM0297
Genbank IDFI856987
TypeSSR
SpeciesCicer arietinum
GermplasmICC4958
Repeat Motif(TAA)18
Primer 1ICCM0297.Forward primer: CATGATTTGATTTGATTTGATTTC
Primer 2ICCM0297.Reverse primer: GGAGTGGGAAACCTTAAGCC
Product Length271
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankFI856987
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerICCM0297.Forward primerCicer arietinumprimer
Reverse primerICCM0297.Reverse primerCicer arietinumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
ICCM0297ICCM0297Cicer arietinummarker_locus
ICCM0297ICCM0297-18.24Cicer arietinummarker_locus


Germplasm
Stock NameType
ICC4958cultivar
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-ICC4958xPI489777-RIL-2011LG1N/A43.3ICCM0297View
2chickpea-ICC4958xPI489777-RIL-F10LG1N/A46.79ICCM0297View
3chickpea-ICC4958xPI489777-RIL-F10-2012LG01N/A61.95ICCM0297View
4chickpea-ICC4958xPI489777-RIL-2010LG1N/A108.1ICCM0297View
5chickpea-ICCV96029×CDCFrontier-F2-2017CaLG01N/A3.8ICCM0297View
6chickpea-ICC5810×CDCFrontier-F2-2017CaLG01N/A27.8ICCM0297View
7chickpea-BGD132×CDCFrontier-F2-2017CaLG01N/A31.1ICCM0297View
8chickpea-ICC16641×CDCFrontier-F2-2017CaLG01N/A41.1ICCM0297View
9chickpea-flowering_time_consensus_map-F2-2017CaLG01N/A30.7ICCM0297View
10Chickpea-ICC4958× ICC1882-RILCaLG01N/A32.01ICCM0297View
11Chickpea-JG62/ICCV05530-RILLG01N/A18.24ICCM0297View