|
Marker Overview
Name | NCPGR139 |
Genbank ID | EU877306 |
Type | STMS |
Species | Cicer arietinum |
Repeat Motif | (GA)40 |
Primer 1 | NCPGR139.Forward primer: TGGGTCTTATTGGGTTTGAT |
Primer 2 | NCPGR139.Reverse primer: CATGCATTTAGGATGAACCA |
Product Length | 245 |
Publication | [view all] |
Contact | Vincent Vadez
|
References
External references for this genetic_marker
Database | Accession |
DB:genbank | EU877306 |
Publications
Year | Publication |
2011 | Gaur R, Sethy NK, Choudhary S, Shokeen B, Gupta V, Bhatia S. Advancing the STMS genomic resources for defining new locations on the intraspecific genetic linkage map of chickpea (Cicer arietinum L.). BMC genomics. 2011; 12:117. |
2018 | Sivasakthi K, Thudi M, Tharanya M, Kale SM, Kholová J, Halime MH, Jaganathan D, Baddam R, Thirunalasundari T, Gaur PM, Varshney RK, Vadez V. Plant vigour QTLs co-map with an earlier reported QTL hotspot for drought tolerance while water saving QTLs map in other regions of the chickpea genome. BMC plant biology. 2018 Feb 06; 18(1):29. |
2015 | Gupta S, Kumar T, Verma S, Bharadwaj C, Bhatia S. Development of gene-based markers for use in construction of the chickpea (Cicer arietinum L.) genetic linkage map and identification of QTLs associated with seed weight and plant height. 2015 Oct 7. |
|