|
Marker Overview
Name | NCPGR7 |
Genbank ID | AY255883 |
Type | STMS |
Species | Cicer arietinum |
Germplasm | Pusa362 |
Repeat Motif | (CA)14 |
Primer 1 | NCPGR7.Forward primer: GACCAAGATTAGTAGAACCT |
Primer 2 | NCPGR7.Reverse primer: CTTGATAAGGATGAGTCATG |
Product Length | 222 |
Publication | [view all] |
Contact | Vincent Vadez
|
References
External references for this genetic_marker
Database | Accession |
DB:genbank | AY255883 |
Publications
Year | Publication |
2003 | Sethy NK, Shokeen B, Bhatia S. Isolation and characterization of sequence-tagged microsatellite markers in chickpea (Cicer arietinum L.). Molecular Ecology Notes. 2003; 3:428-430. |
2018 | Sivasakthi K, Thudi M, Tharanya M, Kale SM, Kholová J, Halime MH, Jaganathan D, Baddam R, Thirunalasundari T, Gaur PM, Varshney RK, Vadez V. Plant vigour QTLs co-map with an earlier reported QTL hotspot for drought tolerance while water saving QTLs map in other regions of the chickpea genome. BMC plant biology. 2018 Feb 06; 18(1):29. |
|