PIP160, PIP160 (genetic_marker) Cicer sp. | PulseDB

Marker Overview

Marker Overview


Name	PIP160
Genbank ID	JK313597
Type	EST marker
Species	Cicer sp.
Primer 1	PIP160.Forward primer: GAAATCAACCGAACCCTGAA
Primer 2	PIP160.Reverse primer: CTCGAGCAACAGCAGACAAC
Product Length	300
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	JK313597

Publications


Year	Publication
2012	Choudhary S, Gaur R, Gupta S. EST-derived genic molecular markers: development and utilization for generating an advanced transcript map of chickpea. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2012 May; 124(8):1449-62.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xPI489777-RIL-2012	LG7	N/A	87.8	PIP160	View
2	chickpea-ICC4958xPI489777-RIL-2012-2	LG1	N/A	85.6	PIP160	View
3	chickpea-ICC4958xPI489777-RIL-2015-2	LG1	N/A	6.33	PIP160	View
4	Chickpea-ICC4958/PI489777-RIL-2020	LG01	N/A	107.85	PIP160	View