PIP194, PIP194 (genetic_marker) Cicer sp. | PulseDB

Marker Overview

Marker Overview


Name	PIP194
Genbank ID	JK313669
Type	EST marker
Species	Cicer sp.
Primer 1	PIP194.Forward primer: GAAGCCATGAAGATGGGTGT
Primer 2	PIP194.Reverse primer: AAGCCACCTTCATCACCAAC
Product Length	300
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	JK313669

Publications


Year	Publication
2012	Choudhary S, Gaur R, Gupta S. EST-derived genic molecular markers: development and utilization for generating an advanced transcript map of chickpea. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2012 May; 124(8):1449-62.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xPI489777-RIL-2012	LG7	N/A	92.6	PIP194	View
2	chickpea-ICC4958xPI489777-RIL-2012-2	LG3	N/A	61.8	PIP194	View
3	chickpea-ICC4958xPI489777-RIL-2015-2	LG8	N/A	118.3	PIP194	View
4	Chickpea_SBD377_X_BGD112_RIL	LG2	N/A	48.2	PIP194	View
5	Chickpea-SBD377/BGD112-RIL-High_density	LG01	N/A	121.79	PIP194	View
6	Chickpea-ICC4958/PI489777-RIL-2020	LG08	N/A	163.48	PIP194	View