SNP_40002411, SNP_40002411 (genetic_marker) Cicer arietinum

Marker Overview
NameSNP_40002411
dbSNP IDN/A
TypeSNP
SNP AllelesN/A
5' Flanking SequenceCTGATTTTGGCAGGACGGAAAGAGAGCCAGTTGTAGCGACCAGAGAAGGAA
3' Flanking SequenceCGTCGATTAGGGAGGAAAGAGAGTCCTCGGAGATGGTGGGTGGCAAGTGCCGCACCACGA CCTTGGTCCGATCCGACATGACAAAAAACCCTAGAATTGA
SpeciesCicer arietinum
Publication[view all]
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SNP_40002411SNP_40002411Cicer arietinummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-LasseterxICC3996-F6-RILLG1N/A0SNP_40002411View
2chickpea-S95362xHowzat-F6-RILLG1.1/5N/A0SNP_40002411View
Sequence
>SNP_40002411 ID=SNP_40002411|Name=SNP_40002411|organism=Cicer arietinum|type=genetic_marker|length=152bp
CTGATTTTGGCAGGACGGAAAGAGAGCCAGTTGTAGCGACCAGAGAAGGA
ASCGTCGATTAGGGAGGAAAGAGAGTCCTCGGAGATGGTGGGTGGCAAGT
GCCGCACCACGACCTTGGTCCGATCCGACATGACAAAAAACCCTAGAATT
GA