TA103, TA103 (genetic_marker) Cicer arietinum

Marker Overview
NameTA103
AliasTA103x
TA103y
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(AAT)31
Primer 1TA103.Forward primer: TGAAATATCTAATGTTGCAATTAGGAC
Primer 2TA103.Reverse primer: TATGGATCACATCAAAGAAATAAAAT
Product Length184
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
TA103.Forward primerTA103.Forward primerCicer arietinumprimer
TA103.Reverse primerTA103.Reverse primerCicer arietinumprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Seed yield per plantqSYPL.VijayxICC4958.LG5.ICicer arietinumQTL
Seed yield per plantqSYPL.VijayxICC4958.LG5.IICicer arietinumQTL
Plant heightqPLHGT.ILC588xILC3279.LG2.TH-cont09Cicer arietinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TA103TA103Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-C214xWR315-F2LG2N/A43.9TA103View
2chickpea-ICC4991xICCV04516-F2LG2N/A22.7TA103View
3chickpea-JG62xVijay-VijayxICC4958-RILLG3N/A56.9TA103View
4chickpea-VijayxICC4958-RIL-2011LG5N/A56TA103View
5chickpea-ILC3279xWR315-RIL-2007LG2N/A0TA103View
6chickpea-ILC72xCr5-10-RIL-2006LG2N/A67.6TA103View
7chickpea-ICC3996xILWC184-F2LG2N/A35.5TA103View
8chickpea-ILC72xCr5-10-RIL-2014LG2N/A44.2TA103View
9chickpea-ILC588xILC3279-RIL-F6LG2N/A22.9TA103View
10Chickpea-RIP5-OrtegaLG02N/A21.6TA103View
11Chickpea-RIP8-OrtegaLG02-1N/A0TA103View