TA110, TA110 (genetic_marker) Cicer arietinum

Marker Overview
NameTA110
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(TTA)22
Primer 1TA110.Forward primer: ACACTATAGGTATAGGCATTTAGGCAA
Primer 2TA110.Reverse primer: TTCTTTATAAATATCAGACCGGAAAGA
Product Length220
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerTA110.Forward primerCicer arietinumprimer
Reverse primerTA110.Reverse primerCicer arietinumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Ascochyta blight resistanceqABR.ICCV96029xCDCLuna.LG2Cicer arietinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TA110TA110Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-C214xWR315-F2LG2N/A36.2TA110View
2chickpea-ICC4991xICCV04516-F2LG2N/A32.2TA110View
3chickpea-ICCV96029xCDCCorinne-F2LG2N/A60.5TA110View
4chickpea-ICCV96029xCDCFrontier-F2LG2N/A93.6TA110View
5chickpea-ICCV96029xCDCLuna-F2LG2N/A23.5TA110View
6chickpea-JG62xVijay-RIL-2011LG5N/A59.7TA110View
7chickpea-JG62xVijay-VijayxICC4958-RILLG3N/A35.7TA110View
8chickpea-VijayxICC4958-RIL-2011LG5N/A37.4TA110View
9chickpea-ICC4958xPI489777-RIL-2011LG2N/A73.7TA110View
10chickpea-ICC4958xPI489777-RIL-2012LG2N/A65.4TA110View
11chickpea-ICC4958xPI489777-RIL-2012-2LG2N/A42.7TA110View
12chickpea-ICC4958xPI489777-RIL-F10LG2N/A65.8TA110View
13chickpea-ICCV96029xCDCFrontier-F2-2007LG2N/A93.6TA110View
14chickpea-HadasxCr205-F2LG2BN/A45.2TA110View
15chickpea-LasseterxPI527930-F2LG2N/A32.7TA110View
16chickpea-ILC3279xWR315-RIL-2007LG2N/A14.1TA110View
17chickpea-ICC4958xPI489777-RIL-F10-2012LG02N/A74.73TA110View
18chickpea-ICC3996xILWC184-F2LG2N/A31.8TA110View
19chickpea-LasseterxICC3996-F6-RILLG2.2N/A26TA110View
20chickpea-S95362xHowzat-F6-RILLG2.2N/A19TA110View
21chickpea-ILC72xCr5-10-RIL-2014LG2N/A54.8TA110View
22chickpea-ILC588xILC3279-RIL-F6LG2N/A11.1TA110View
23chickpea-ICC4958xPI489777-RIL-2010LG2N/A229.3TA110View
24chickpea-ICC4958xPI489777-RIL-2015-2LG2N/A82.76TA110View
25chickpea-ICCV96029×CDCFrontier-F2-2017CaLG02N/A6TA110View
26chickpea-ICCV96029×CDCFrontier-F2-2017CaLG05N/A2.3TA110View
27chickpea-BGD132×CDCFrontier-F2-2017CaLG02N/A10.4TA110View
28chickpea-ICC16641×CDCFrontier-F2-2017CaLG02N/A41.8TA110View
29chickpea-flowering_time_consensus_map-F2-2017CaLG02N/A36.9TA110View
30Chickpea-JG62xVijayxVijayxICC4958-RILLG3 (LGII+VIII)N/A35.7TA110View
31Chickpea-ICCL81001_x_Cr5-9-RILLG2N/A50.2TA110View
32Chickpea-JG62_X_WR315-RILLG2N/A27.1TA110View
33Chickpea-ICC4958× ICC1882-RILCaLG02N/A27.24TA110View
34Chickpea-RIP12-OrtegaLG02N/A8.5TA110View
35Chickpea-RIP5-OrtegaLG02N/A16.1TA110View
36Chickpea-RIP8-OrtegaLG02-1N/A5.5TA110View