TA110, TA110 (genetic_marker) Cicer arietinum

Marker Overview


Name	TA110
Genbank ID	N/A
Type	STMS
Species	Cicer arietinum
Germplasm	ILC3279
Repeat Motif	(TTA)22
Primer 1	TA110.Forward primer: ACACTATAGGTATAGGCATTTAGGCAA
Primer 2	TA110.Reverse primer: TTCTTTATAAATATCAGACCGGAAAGA
Product Length	220
Publication	[view all]

Relationships

This genetic_marker is adjacent to the following primer feature(s):


Feature Name	Unique Name	Species	Type
Forward primer	TA110.Forward primer	Cicer arietinum	primer
Reverse primer	TA110.Reverse primer	Cicer arietinum	primer

This genetic_marker is adjacent to the following QTL feature(s):


Feature Name	Unique Name	Species	Type
Ascochyta blight resistance	qABR.ICCV96029xCDCLuna.LG2	Cicer arietinum	QTL

The following marker_locus feature(s) are an instance of this genetic_marker:


Feature Name	Unique Name	Species	Type
TA110	TA110	Cicer arietinum	marker_locus

Publications


Year	Publication
1999	Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101.
2013	Sabbavarapu MM, Sharma M, Chamarthi SK, Swapna N, Rathore A, Thudi M, Gaur PM, Pande S, Singh S, Kaur L, Varshney RK. Molecular mapping of QTLs for resistance to Fusarium wilt (race 1) and Ascochyta blight in chickpea (Cicer arietinum L.). Euphytica. 2013; 193(1):121-133.
2007	Radhika P, Gowda SJM, Kadoo NY, Mhase LB, Jamadagni BM, Sainani MN, Chandra S, Gupta VS. Development of an integrated intraspecific map of chickpea (Cicer arietinum L.) using two recombinant inbred line populations. Theoretical and applied genetics TAG. 2007; 115(2):209-216.
2014	Patil B, Ravikumar R, Bhat J, Soregaon C. Molecular mapping of QTLs for resistance to early and late Fusarium wilt in chickpea. Czech journal of genetics and plant breeding. 2014; 50(2):171-176.

Germplasm


Stock Name	Type
ILC3279	breeding_research_material

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-C214xWR315-F2	LG2	N/A	36.2	TA110	View
2	chickpea-ICC4991xICCV04516-F2	LG2	N/A	32.2	TA110	View
3	chickpea-ICCV96029xCDCCorinne-F2	LG2	N/A	60.5	TA110	View
4	chickpea-ICCV96029xCDCFrontier-F2	LG2	N/A	93.6	TA110	View
5	chickpea-ICCV96029xCDCLuna-F2	LG2	N/A	23.5	TA110	View
6	chickpea-JG62xVijay-RIL-2011	LG5	N/A	59.7	TA110	View
7	chickpea-JG62xVijay-VijayxICC4958-RIL	LG3	N/A	35.7	TA110	View
8	chickpea-VijayxICC4958-RIL-2011	LG5	N/A	37.4	TA110	View
9	chickpea-ICC4958xPI489777-RIL-2011	LG2	N/A	73.7	TA110	View
10	chickpea-ICC4958xPI489777-RIL-2012	LG2	N/A	65.4	TA110	View
11	chickpea-ICC4958xPI489777-RIL-2012-2	LG2	N/A	42.7	TA110	View
12	chickpea-ICC4958xPI489777-RIL-F10	LG2	N/A	65.8	TA110	View
13	chickpea-ICCV96029xCDCFrontier-F2-2007	LG2	N/A	93.6	TA110	View
14	chickpea-HadasxCr205-F2	LG2B	N/A	45.2	TA110	View
15	chickpea-LasseterxPI527930-F2	LG2	N/A	32.7	TA110	View
16	chickpea-ILC3279xWR315-RIL-2007	LG2	N/A	14.1	TA110	View
17	chickpea-ICC4958xPI489777-RIL-F10-2012	LG02	N/A	74.73	TA110	View
18	chickpea-ICC3996xILWC184-F2	LG2	N/A	31.8	TA110	View
19	chickpea-LasseterxICC3996-F6-RIL	LG2.2	N/A	26	TA110	View
20	chickpea-S95362xHowzat-F6-RIL	LG2.2	N/A	19	TA110	View
21	chickpea-ILC72xCr5-10-RIL-2014	LG2	N/A	54.8	TA110	View
22	chickpea-ILC588xILC3279-RIL-F6	LG2	N/A	11.1	TA110	View
23	chickpea-ICC4958xPI489777-RIL-2010	LG2	N/A	229.3	TA110	View
24	chickpea-ICC4958xPI489777-RIL-2015-2	LG2	N/A	82.76	TA110	View
25	chickpea-ICCV96029×CDCFrontier-F2-2017	CaLG02	N/A	6	TA110	View
26	chickpea-ICCV96029×CDCFrontier-F2-2017	CaLG05	N/A	2.3	TA110	View
27	chickpea-BGD132×CDCFrontier-F2-2017	CaLG02	N/A	10.4	TA110	View
28	chickpea-ICC16641×CDCFrontier-F2-2017	CaLG02	N/A	41.8	TA110	View
29	chickpea-flowering_time_consensus_map-F2-2017	CaLG02	N/A	36.9	TA110	View
30	Chickpea-JG62xVijayxVijayxICC4958-RIL	LG3 (LGII+VIII)	N/A	35.7	TA110	View
31	Chickpea-ICCL81001_x_Cr5-9-RIL	LG2	N/A	50.2	TA110	View
32	Chickpea-JG62_X_WR315-RIL	LG2	N/A	27.1	TA110	View
33	Chickpea-ICC4958× ICC1882-RIL	CaLG02	N/A	27.24	TA110	View
34	Chickpea-RIP12-Ortega	LG02	N/A	8.5	TA110	View
35	Chickpea-RIP5-Ortega	LG02	N/A	16.1	TA110	View
36	Chickpea-RIP8-Ortega	LG02-1	N/A	5.5	TA110	View