|
Marker Overview
Name | TA110 |
Genbank ID | N/A |
Type | STMS |
Species | Cicer arietinum |
Germplasm | ILC3279 |
Repeat Motif | (TTA)22 |
Primer 1 | TA110.Forward primer: ACACTATAGGTATAGGCATTTAGGCAA |
Primer 2 | TA110.Reverse primer: TTCTTTATAAATATCAGACCGGAAAGA |
Product Length | 220 |
Publication | [view all] |
Publications
Year | Publication |
1999 | Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101. |
2013 | Sabbavarapu MM, Sharma M, Chamarthi SK, Swapna N, Rathore A, Thudi M, Gaur PM, Pande S, Singh S, Kaur L, Varshney RK. Molecular mapping of QTLs for resistance to Fusarium wilt (race 1) and Ascochyta blight in chickpea (Cicer arietinum L.). Euphytica. 2013; 193(1):121-133. |
2007 | Radhika P, Gowda SJM, Kadoo NY, Mhase LB, Jamadagni BM, Sainani MN, Chandra S, Gupta VS. Development of an integrated intraspecific map of chickpea (Cicer arietinum L.) using two recombinant inbred line populations. Theoretical and applied genetics TAG. 2007; 115(2):209-216. |
2014 | Patil B, Ravikumar R, Bhat J, Soregaon C. Molecular mapping of QTLs for resistance to early and late Fusarium wilt in chickpea. Czech journal of genetics and plant breeding. 2014; 50(2):171-176. |
|