TA113, TA113 (genetic_marker) Cicer arietinum

Marker Overview
NameTA113
AliasTA113-169
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(TAA)26
Primer 1TA113.Forward primer: TCTGCAAAAACTATTACGTTAATACCA
Primer 2TA113.Reverse primer: TTGTGTGTAATGGATTGAGTATCTCTT
Product Length203
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
TA113.Forward primerTA113.Forward primerCicer arietinumprimer
TA113.Reverse primerTA113.Reverse primerCicer arietinumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Seed colorqSDCL.ICC3996xS95362.LG5.H.CIE_LCicer arietinumQTL
Seed colorqSDCL.ICC3996xS95362.LG5.M.CIE_LCicer arietinumQTL
Seed colorqSDCL.ICC3996xS95362.LG5.H.hCicer arietinumQTL
Seed colorqSDCL.ICC3996xS95362.LG5.M.hCicer arietinumQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Plant heightqPLHGT.ILC588xILC3279.LGU.Terbol-11Cicer arietinumQTL
Days to maturityqDM.ILC588xILC3279.LGU.TH-cont09.2Cicer arietinumQTL
Harvest indexqHI.ILC588xILC3279.LGU.TH-cont08Cicer arietinumQTL
Percent empty podqPEP.ILC588xILC3279.LGU.TH-cont08Cicer arietinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TA113TA113Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-ICC4991xICCV04516-F2LG1N/A3.4TA113View
2chickpea-ICCV96029xCDCFrontier-F2LG1N/A78.9TA113View
3chickpea-ILC3279xICCV2-F3LG1N/A31.8TA113View
4chickpea-JG62xVijay-VijayxICC4958-RILLG2N/A34.3TA113View
5chickpea-VijayxICC4958-RIL-2011LG1aN/A22.2TA113View
6chickpea-ICC4958xPI489777-RIL-2011LG1N/A66.8TA113View
7chickpea-ICC4958xPI489777-RIL-2012LG1N/A188.1TA113View
8chickpea-ICCV2xJG62-RIL-F10-2011LGIIN/A18.6TA113View
9chickpea-ICC4958xPI489777-RIL-2012-2LG1N/A132.3TA113View
10chickpea-ICCV96029xCDCFrontier-F2-2007LG1N/A78.9TA113View
11chickpea-ICC4958xPI489777-RIL-F10-2012LG01N/A81.02TA113View
12chickpea-ICC12004xLasseter-F2LGIVN/A11.9TA113View
13chickpea-ICC12004xLasseter-F2LGVIN/A16.2TA113View
14chickpea-ICC3996xILWC184-F2LG1N/A0TA113View
15chickpea-LasseterxICC3996-F6-RILLG1N/A109.2TA113View
16chickpea-ICC4958xPI489777-RIL-2010LG1N/A33.4TA113View
17chickpea-ICC4958xPI489777-RIL-2015-2LG1N/A90.04TA113View
18Chickpea-JG62xVijayxVijayxICC4958-RILLG2 (LGI+IV)N/A34.3TA113View
19Chickpea_SBD377_X_BGD112_RILLG1N/A90TA113View