TA122, TA122 (genetic_marker) Cicer arietinum

Marker Overview
NameTA122
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
Primer 1TA122.Forward Primer: AATGCTACAAATTATTAAAAACAGTC
Primer 2TA122.Reverse Primer: AACTTTTAGTGTGCTGACGAGT
Publication[view all]
Relationships

This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Beta-carotene contentqBCARC.HadasxCr205.LG1BCicer sp.QTL


This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerTA122.Forward PrimerCicer arietinumprimer
Reverse PrimerTA122.Reverse PrimerCicer arietinumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TA122TA122Cicer arietinummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-ICCV96029xCDCCorinne-F2LG1N/A0TA122View
2chickpea-ICCV96029xCDCFrontier-F2LG1N/A0TA122View
3chickpea-ICCV96029xCDCLuna-F2LG1N/A0TA122View
4chickpea-ICCV96029xCDCFrontier-F2-2007LG1N/A0TA122View
5chickpea-HadasxCr205-F2LG1BN/A15.6TA122View
6chickpea-ICC5810×CDCFrontier-F2-2017CaLG01N/A0TA122View
7chickpea-BGD132×CDCFrontier-F2-2017CaLG01N/A0TA122View
8chickpea-ICC16641×CDCFrontier-F2-2017CaLG01N/A0TA122View
9chickpea-flowering_time_consensus_map-F2-2017CaLG01N/A0TA122View