TA144, TA144 (genetic_marker) Cicer arietinum

Name	TA144
Genbank ID	N/A
Type	STMS
Species	Cicer arietinum
Germplasm	ILC3279
Repeat Motif	(TAA)27
Primer 1	TA144.Forward primer: TATTTTAATCCGGTGAATATTACCTTT
Primer 2	TA144.Reverse primer: GTGGAGTCACTATCAACAATCATACAT
Product Length	241
Publication	[view all]

Year	Publication
1999	Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101.
2007	Radhika P, Gowda SJM, Kadoo NY, Mhase LB, Jamadagni BM, Sainani MN, Chandra S, Gupta VS. Development of an integrated intraspecific map of chickpea (Cicer arietinum L.) using two recombinant inbred line populations. Theoretical and applied genetics TAG. 2007; 115(2):209-216.

Stock Name	Type
ILC3279	accession

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4991xICCV04516-F2	LG8A	N/A	45.5	TA144	View
2	chickpea-ICCV2xJG62-F10-RIL	LG3	N/A	32	TA144	View
3	chickpea-ICCV2xJG62-RIL	LG4	N/A	3.5	TA144	View
4	chickpea-ICCV96029xCDCFrontier-F2	LG8	N/A	66.3	TA144	View
5	chickpea-ICCV96029xCDCLuna-F2	LG8	N/A	46.6	TA144	View
6	chickpea-JG62xVijay-RIL-2011	LG6	N/A	38.5	TA144	View
7	chickpea-JG62xVijay-VijayxICC4958-RIL	LG6	N/A	38.5	TA144	View
8	chickpea-ICCV96029xCDCFrontier-F2-2007	LG8	N/A	66.3	TA144	View
9	chickpea-LasseterxICC3996-F6-RIL	LG8	N/A	38.7	TA144	View
10	chickpea-S95362xHowzat-F6-RIL	LG8	N/A	13.1	TA144	View
11	chickpea-ICCV96029×CDCFrontier-F2-2017	CaLG08	N/A	45.2	TA144	View
12	chickpea-ICC5810×CDCFrontier-F2-2017	CaLG08	N/A	56.6	TA144	View
13	chickpea-BGD132×CDCFrontier-F2-2017	CaLG08	N/A	4.5	TA144	View
14	chickpea-flowering_time_consensus_map-F2-2017	CaLG08	N/A	28.7	TA144	View
15	Chickpea-JG62xVijayxVijayxICC4958-RIL	LG6 (LGVIII)	N/A	38.5	TA144	View
16	Chickpea-RIP5-Ortega	LG08-2	N/A	5.7	TA144	View
17	Chickpea-RIP8-Ortega	LG08	N/A	0.9	TA144	View
18	Chickpea-JG62/ICCV05530-RIL	LG08	N/A	26.93	TA144	View