TA176, TA176 (genetic_marker) Cicer arietinum

Name	TA176
Genbank ID	N/A
Type	STMS
Species	Cicer arietinum
Germplasm	ILC3279
Repeat Motif	(TAA)40(GAA)9
Primer 1	TA176.Forward primer: ATTTGGCTTAAACCCTCTTC
Primer 2	TA176.Reverse primer: TTTATGCTTCCTCTTCTTCG
Product Length	233
Publication	[view all]
Comment	17984

Year	Publication
1999	Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101.
2015	Gupta S, Kumar T, Verma S, Bharadwaj C, Bhatia S. Development of gene-based markers for use in construction of the chickpea (Cicer arietinum L.) genetic linkage map and identification of QTLs associated with seed weight and plant height. 2015 Oct 7.

Stock Name	Type
ILC3279	accession

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4991xICCV04516-F2	LG6	N/A	37	TA176	View
2	chickpea-ICCV2xJG62-F10-RIL	LG6A	N/A	39	TA176	View
3	chickpea-ICCV2xJG62-RIL	LG3	N/A	96	TA176	View
4	chickpea-ICCV96029xAmit-F2	LG6	N/A	42.7	TA176	View
5	chickpea-ICCV96029xCDCCorinne-F2	LG6	N/A	51.7	TA176	View
6	chickpea-ICCV96029xCDCFrontier-F2	LG6	N/A	140.3	TA176	View
7	chickpea-ICCV96029xCDCLuna-F2	LG6	N/A	37.5	TA176	View
8	chickpea-ILC3279xICCV2-F3	LG4	N/A	22.4	TA176	View
9	chickpea-JG62xVijay-RIL-2011	LG4	N/A	38.4	TA176	View
10	chickpea-JG62xVijay-VijayxICC4958-RIL	LG4	N/A	42.2	TA176	View
11	chickpea-VijayxICC4958-RIL-2011	LG4	N/A	18.5	TA176	View
12	chickpea-ICC4958xPI489777-RIL-2012	LG6	N/A	192.1	TA176	View
13	chickpea-ICCV2xJG62-RIL-F10-2011	LGVI	N/A	45.9	TA176	View
14	chickpea-ICC4958xPI489777-RIL-2012-2	LG6	N/A	26.9	TA176	View
15	chickpea-ICC4958xPI489777-RIL-F10	LG6	N/A	91.24	TA176	View
16	chickpea-ICCV96029xCDCFrontier-F2-2007	LG6	N/A	140.3	TA176	View
17	chickpea-HadasxCr205-F2	LG6B	N/A	26.4	TA176	View
18	chickpea-ICC4958xPI489777-RIL-F10-2012	LG06	N/A	53.71	TA176	View
19	chickpea-ICC12004xLasseter-F2	LGV	N/A	18.8	TA176	View
20	chickpea-ICC3996xILWC184-F2	LG6	N/A	46.7	TA176	View
21	chickpea-ILC588xILC3279-RIL-F6	LG6	N/A	1.3	TA176	View
22	chickpea-ICC4958xPI489777-RIL-2015-2	LG6	N/A	79.87	TA176	View
23	Chickpea-RIP-1_x_RIP-1-RIL-genetic	LG6	N/A	20.8	TA176	View
24	Chickpea-CPR-01_x_CRP-01-RIL-physical	LG6	N/A	48041944	TA176	View
25	chickpea-ICCV96029×CDCFrontier-F2-2017	CaLG06	N/A	28.6	TA176	View
26	chickpea-ICC5810×CDCFrontier-F2-2017	CaLG06	N/A	29.3	TA176	View
27	chickpea-ICC16641×CDCFrontier-F2-2017	CaLG06	N/A	27.9	TA176	View
28	chickpea-flowering_time_consensus_map-F2-2017	CaLG06	N/A	30.4	TA176	View
29	Chickpea_SBD377_X_BGD112_RIL	LG6	N/A	106.7	TA176	View
30	Chickpea-RIP5-Ortega	LG06	N/A	2.3	TA176	View
31	Chickpea-SBD377/BGD112-RIL-High_density	LG06	N/A	79.48	TA176	View
32	Chickpea-ICC4958/PI489777-RIL-2020	LG06	N/A	177.19	TA176	View
33	Chickpea-JG62/ICCV05530-RIL	LG06	N/A	35.31	TA176	View